-
Connexin 32 and 43 promoter methylation in Helicobacter pylori-associated gastric tumorigenesis
Yu Wang, Li-Hua Huang, Can-Xia Xu, Jing Xiao, Li Zhou, - World J Gastroenterol - 2014 Sep 7
… The PCR products were introduced with T7 promoter sequence in the Beijing Bio-Miao Biotech Company, then in vitro transcribed to RNA products, processed by T-base-specific cleavage, and small RNA fragments were obtained … -
Cerebrotendinous xanthomatosis with bradyphrenia and psychiatric disorders: a case with 18F-FDG PET i
Shimeng Yu, Rong Deng, Yang Tanc, Yunjian Zhang - Eur. J. Psychiat - 24 November 2015
… 3'; exon6-8: Forward5' CT- CATACACCCTCCCATTACTG 3', Rever - se5' ACACTCCTACCCTGTGCCTC 3'; exon9: Forward5'TACTCCTCGCAAGGG TGA3', Reverse5'CCTCAGATGCTGGGTAGTCA 3'. The DNA sequences were ana- lyzed directly (Bio Miao Biological, Beijing … -
Association of PTTG1 polymorphism rs1895320, rs2910200 and rs6882742 with non-functioning pituitary a
Bin Zhu,Ming Gao,Lei Zhang,Juan Wang,Lei Wang - Metabolic Brain Disease - 03 January 2019
… Genotyping analysis was performed by time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). The average genotype call rate for the SNP was >98%. Meta-analysis … -
Loss of Cardio-Protective Effects at the CDH13 Locus Due to Gene-Sleep Interaction: The BCAMS Study
GeLi,DanFeng,Yonghui Wang,Junling Fu - EBioMedicine - June 2018
… of adiponectin in East Asians [5, 7, 30, 42], ADIPOQ rs10937273, rs6773957, CDH13 rs4783244,WDR11FGF rs3943077, CMIP rs2925979, and PEPD rs889140, and were genotype on the Sequenom Mass Array iPLEX genotyping platform in BioMiao Biological Technology Co … -
Association between acromegaly and a single nucleotide polymorphism (rs2854744) in the IGFBP3 gene
Ming Gao, Bin Zhu, Zhe Xu, Shujun Liu, Jiajia Liu - BMC Medical Genetics - 5 October 2018
… Genotyping analysis of the included population was performed using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). Determination of serum IGFBP3 concentration … -
Genetic polymorphisms and valproic acid plasma concentration in children with epilepsy on valproic ac
Shenghui Mei,Weixing Feng,Leting Zhu,YazhenYu - Seizure - October 2017
… Patients' DNA were isolated by QIAamp DNA purification kit (Qiagen, Hilden, Germany). Genotyping was performed by Bio Miao Biological Technology (Beijing) by MassArray method (Sequenom, USA) [29]. 2.4. Statistical analysis … -
Changes in body mass index, leptin, and leptin receptor polymorphisms and breast cancer risk
Chun-Rong Liu, Qin Li, Can Hou, Hui Li, Ping Shuai, - DNA and Cell Biology - 1 Mar 2018
… Genomic DNA was extracted from whole blood using a TIANamp Blood DNA Kit. LEP and LEPRgenotypes were then determined by time- of-flight mass spectrometer (Applied BIO MIAO, Beijing,China). Assay Designer 3.1 was used to design the primers … -
Association of serotonergic pathway genes with smoking cessation in a Chinese rural male population
Qiang Wang,Suyun Li,Huijie Li,Chongqi Jia - Addictive Behaviors - May 2018
… (Beijing, China) (DP318). SNPs were genotyped by Bio Miao Biological Technology (Beijing) Co., Ltd. Primers and multiplex reactions were designed using AssayDesigner 3.1 and the RealSNP.com Website (http://www.mysequenom.com), respectively …
文章搜索
文章搜索
-
Connexin 32 and 43 promoter methylation in Helicobacter pylori-associated gastric tumorigenesis
Yu Wang, Li-Hua Huang, Can-Xia Xu, Jing Xiao, Li Zhou, - World J Gastroenterol - 2014 Sep 7
… The PCR products were introduced with T7 promoter sequence in the Beijing Bio-Miao Biotech Company, then in vitro transcribed to RNA products, processed by T-base-specific cleavage, and small RNA fragments were obtained … -
Cerebrotendinous xanthomatosis with bradyphrenia and psychiatric disorders: a case with 18F-FDG PET i
Shimeng Yu, Rong Deng, Yang Tanc, Yunjian Zhang - Eur. J. Psychiat - 24 November 2015
… 3'; exon6-8: Forward5' CT- CATACACCCTCCCATTACTG 3', Rever - se5' ACACTCCTACCCTGTGCCTC 3'; exon9: Forward5'TACTCCTCGCAAGGG TGA3', Reverse5'CCTCAGATGCTGGGTAGTCA 3'. The DNA sequences were ana- lyzed directly (Bio Miao Biological, Beijing … -
Association of PTTG1 polymorphism rs1895320, rs2910200 and rs6882742 with non-functioning pituitary a
Bin Zhu,Ming Gao,Lei Zhang,Juan Wang,Lei Wang - Metabolic Brain Disease - 03 January 2019
… Genotyping analysis was performed by time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). The average genotype call rate for the SNP was >98%. Meta-analysis … -
Loss of Cardio-Protective Effects at the CDH13 Locus Due to Gene-Sleep Interaction: The BCAMS Study
GeLi,DanFeng,Yonghui Wang,Junling Fu - EBioMedicine - June 2018
… of adiponectin in East Asians [5, 7, 30, 42], ADIPOQ rs10937273, rs6773957, CDH13 rs4783244,WDR11FGF rs3943077, CMIP rs2925979, and PEPD rs889140, and were genotype on the Sequenom Mass Array iPLEX genotyping platform in BioMiao Biological Technology Co … -
Association between acromegaly and a single nucleotide polymorphism (rs2854744) in the IGFBP3 gene
Ming Gao, Bin Zhu, Zhe Xu, Shujun Liu, Jiajia Liu - BMC Medical Genetics - 5 October 2018
… Genotyping analysis of the included population was performed using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). Determination of serum IGFBP3 concentration … -
Genetic polymorphisms and valproic acid plasma concentration in children with epilepsy on valproic ac
Shenghui Mei,Weixing Feng,Leting Zhu,YazhenYu - Seizure - October 2017
… Patients' DNA were isolated by QIAamp DNA purification kit (Qiagen, Hilden, Germany). Genotyping was performed by Bio Miao Biological Technology (Beijing) by MassArray method (Sequenom, USA) [29]. 2.4. Statistical analysis … -
Changes in body mass index, leptin, and leptin receptor polymorphisms and breast cancer risk
Chun-Rong Liu, Qin Li, Can Hou, Hui Li, Ping Shuai, - DNA and Cell Biology - 1 Mar 2018
… Genomic DNA was extracted from whole blood using a TIANamp Blood DNA Kit. LEP and LEPRgenotypes were then determined by time- of-flight mass spectrometer (Applied BIO MIAO, Beijing,China). Assay Designer 3.1 was used to design the primers … -
Association of serotonergic pathway genes with smoking cessation in a Chinese rural male population
Qiang Wang,Suyun Li,Huijie Li,Chongqi Jia - Addictive Behaviors - May 2018
… (Beijing, China) (DP318). SNPs were genotyped by Bio Miao Biological Technology (Beijing) Co., Ltd. Primers and multiplex reactions were designed using AssayDesigner 3.1 and the RealSNP.com Website (http://www.mysequenom.com), respectively …