-
Association of PTTG1 polymorphism rs1895320, rs2910200 and rs6882742 with non-functioning pituitary a
B Zhu, M Gao, L Zhang, J Wang, L Wang, LL Qin… - Springer - Metabolic brain …, 2019
… Genotyping analysis was performed by time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). The average genotype call rate for the SNP was >98%. Meta-analysis … -
Cerebrotendinous xanthomatosis with bradyphrenia and psychiatric disorders: a case with 18F-FDG PET i
S Yu, R Deng, Y Tan, Y Zhang - SciELO Espana - The European Journal of …, 2016
… 3'; exon6-8: Forward5' CT- CATACACCCTCCCATTACTG 3', Rever - se5' ACACTCCTACCC TGTGCCTC 3'; exon9: Forward5'TACTCCTCGCAAGGG TGA3', Reverse5'CCTCAGATGCTGGGT AGTCA 3'. The DNA sequences were ana- lyzed directly (Bio Miao Biological, Beijing … -
Connexin 32 and 43 promoter methylation in Helicobacter pylori-associated gastric tumorigenesis
Y Wang, LH Huang, CX Xu, J Xiao, L Zhou… - ncbi.nlm.nih.gov - World Journal of …, 2014
… The PCR products were introduced with T7 promoter sequence in the Beijing Bio-Miao Biotech Company, then in vitro transcribed to RNA products, processed by T-base-specific cleavage, and small RNA fragments were obtained … -
rs2243268 and rs2243274 of Interleukin-4 (IL-4) gene are associated with reduced risk for extrapulmo
H Qi, L Sun, YQ Jin, C Shen, P Chu, SF Wang… - Elsevier - Infection, Genetics and …, 2014
… for our genotyping analysis. MassArray (Sequenom, USA) was used for genotypingall SNPs (Gabriel et al., 2009) and this assay was accomplished by Bio MiaoBiological Technology (Beijing, China). As MAF of two reported … -
Polymorphism of the programmed death‐ligand 1 gene is associated with its protein expression and pr
Y Wu, T Zhao, Z Jia, D Cao, X Cao… - Wiley Online Library - Journal of …, 2018
… The characteristics of SNPs are shown in Table S1. SNP genotyping was conducted using the MassARRAY technology platform (Sequenom, CA, USA) and determined by the Bio Miao Biological Technology Co., Ltd. (Beijing). Immunohistochemistry … -
Association of IL-10 and IL-10RA single nucleotide polymorphisms with the responsiveness to HBV vacci
S Wen, Y Wu, Y Pan, M Cao, D Zhao, C Wang… - BMJ open, 2018 - bmjopen.bmj.com
Skip to main content. We use cookies to improve our service and to tailor our content and advertising to you. More info You can manage your cookie settings via your browser at any time. To learn more about how we use cookies, please see our cookies policy … -
Influence of the IGFBP3-202A/C Gene Polymorphism on Clinical Features and Surgery Outcome in Acromega
M Gao, B Zhu, P Li, G Zhang, K Chen, H Lv… - ncbi.nlm.nih.gov - Frontiers in …, 2018
… Genotyping analysis of the included population was performed using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). Statistical Analysis … -
20 μg hepatitis B vaccination reduced the risk of low responsiveness in infants with HLA-II risk gen
MZ Cao, YH Wu, SM Wen, Y Pan, C Wang… - Elsevier - Infection, Genetics and …, 2018
… Genotyping of each SNP was conducted using the MassARRAY technology platform (Sequenom, CA, USA) and determined by Bio Miao Biological Technology (Beijing) Co., Ltd. The call rates for the five SNPs above were 99.3%, 99.4%, 97.1%, 98.9%, and 99.1%, respectively …
文章搜索
文章搜索
-
Association of PTTG1 polymorphism rs1895320, rs2910200 and rs6882742 with non-functioning pituitary a
B Zhu, M Gao, L Zhang, J Wang, L Wang, LL Qin… - Springer - Metabolic brain …, 2019
… Genotyping analysis was performed by time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). The average genotype call rate for the SNP was >98%. Meta-analysis … -
Cerebrotendinous xanthomatosis with bradyphrenia and psychiatric disorders: a case with 18F-FDG PET i
S Yu, R Deng, Y Tan, Y Zhang - SciELO Espana - The European Journal of …, 2016
… 3'; exon6-8: Forward5' CT- CATACACCCTCCCATTACTG 3', Rever - se5' ACACTCCTACCC TGTGCCTC 3'; exon9: Forward5'TACTCCTCGCAAGGG TGA3', Reverse5'CCTCAGATGCTGGGT AGTCA 3'. The DNA sequences were ana- lyzed directly (Bio Miao Biological, Beijing … -
Connexin 32 and 43 promoter methylation in Helicobacter pylori-associated gastric tumorigenesis
Y Wang, LH Huang, CX Xu, J Xiao, L Zhou… - ncbi.nlm.nih.gov - World Journal of …, 2014
… The PCR products were introduced with T7 promoter sequence in the Beijing Bio-Miao Biotech Company, then in vitro transcribed to RNA products, processed by T-base-specific cleavage, and small RNA fragments were obtained … -
rs2243268 and rs2243274 of Interleukin-4 (IL-4) gene are associated with reduced risk for extrapulmo
H Qi, L Sun, YQ Jin, C Shen, P Chu, SF Wang… - Elsevier - Infection, Genetics and …, 2014
… for our genotyping analysis. MassArray (Sequenom, USA) was used for genotypingall SNPs (Gabriel et al., 2009) and this assay was accomplished by Bio MiaoBiological Technology (Beijing, China). As MAF of two reported … -
Polymorphism of the programmed death‐ligand 1 gene is associated with its protein expression and pr
Y Wu, T Zhao, Z Jia, D Cao, X Cao… - Wiley Online Library - Journal of …, 2018
… The characteristics of SNPs are shown in Table S1. SNP genotyping was conducted using the MassARRAY technology platform (Sequenom, CA, USA) and determined by the Bio Miao Biological Technology Co., Ltd. (Beijing). Immunohistochemistry … -
Association of IL-10 and IL-10RA single nucleotide polymorphisms with the responsiveness to HBV vacci
S Wen, Y Wu, Y Pan, M Cao, D Zhao, C Wang… - BMJ open, 2018 - bmjopen.bmj.com
Skip to main content. We use cookies to improve our service and to tailor our content and advertising to you. More info You can manage your cookie settings via your browser at any time. To learn more about how we use cookies, please see our cookies policy … -
Influence of the IGFBP3-202A/C Gene Polymorphism on Clinical Features and Surgery Outcome in Acromega
M Gao, B Zhu, P Li, G Zhang, K Chen, H Lv… - ncbi.nlm.nih.gov - Frontiers in …, 2018
… Genotyping analysis of the included population was performed using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, USA) in Bio Miao Biological Technology (Beijing). Statistical Analysis … -
20 μg hepatitis B vaccination reduced the risk of low responsiveness in infants with HLA-II risk gen
MZ Cao, YH Wu, SM Wen, Y Pan, C Wang… - Elsevier - Infection, Genetics and …, 2018
… Genotyping of each SNP was conducted using the MassARRAY technology platform (Sequenom, CA, USA) and determined by Bio Miao Biological Technology (Beijing) Co., Ltd. The call rates for the five SNPs above were 99.3%, 99.4%, 97.1%, 98.9%, and 99.1%, respectively …


