-
Pharmacogenetics-based warfarin dose prediction algorithm for patients with heart valve replacement i
M.Q. Lin1 , J. Zhang, H.F. Qiu , X.B. Xie - Genetics and Molecular Research - July 28, 2017
Whole blood DNA was extracted using a whole blood genomic DNA rapid extraction kit (centrifugal column), (Beijing BioTeke Corporation, Beijing, China.) A time-of-flight mass spectrometry platform (Sequenom) was used for genotyping (BioMiao Biological Technology (Beijing) Co., Ltd., Beijing, China). -
Toll-like receptor 1 (TLR1) Gene SNP rs5743618 is associated with increased risk for tuberculosis in
Hui Qi,Lin Sun,Xirong,Wu, Yaqiong,Jin,JingXiao,Shengfeng Wang - Tuberculosis - March 2015
… MassArray (Sequenom, USA) was used for genotyping all SNPs [24] and this assay was accomplished by Bio Miao Biological Technology (Beijing). 2.3. Cytokine assays. Whole blood was harvested from children in control group with different genotypes of rs5743618 … -
A 3'UTR Polymorphism of IL-6R Is Associated with Chinese Pediatric Tuberculosis
Chen Shen, Hui Qi, Lin Sun, Jing Xiao, Qing-qin Yin, - BioMed Research International - 19 March 2014
… MassArray (Sequenom, USA) was used for genotyping selected tag-SNPs (Gabriel et al., 2009),and this assay was accomplished by Bio Miao Biological Technology (Beijing, China). The primers were designed using iPLEX GOLD (Sequenom, USA) [17]. 2.4 … -
FGFR2 gene polymorphism rs2981582 is associated with non-functioning pituitary adenomas in Chinese Ha
Bin Zhu1, Juan Wang , Lingling Qin , Lei Wang , Yanfei Zheng - Bioscience Reports - 30 August 2018
Polymerase chain reaction (PCR) primer pairs used to amplify FGFR2 rs2981582 were as follows: ACTGCTGCGGGTTCCTAAAG (forward); CACTCATCGCCACTTAATG (reverse). Genotyping was performed by using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, U.S.A.) by Bio Miao Biological Technology (Beijing, China). The average genotype call rate for this SNP was >98%.
Strong association of SLC1A1 and DPF3 gene variants with idiopathic male infertility in Han Chinese
Shu-Yuan Liu, Chang-Jun Zhang, Hai-Ying Peng - Asian J Androl - 2016 May 27.
Genotyping of SNPs was performed using the Sequenom MassARRAY platform (Sequenom iPLEX assay, San Diego, CA, USA; Biomiao Biology Corporation, Beijing, China). PCR and single base extension (SBE) primers were designed using the MassARRAY Designer software, version 3.1 (Sequenom, San Diego, CA, USA).Associations of polymorphisms in circadian genes with abdominal obesity in Chinese adult population
DingYe,ShaofangCai, XiyiJiang,YeDing,KunChen - Obesity Research & Clinical Practice - September 2016
… Genotyping for all SNPs was performed by the MassARRAY molecular weight array analysis system (BioMiao Biological Technology Co., Beijing, China). The call rate and consistency rate for each SNP were >93% and 100%, respectively. Statistical analysis …Influence of lifestyle on the FAIM2 promoter methylation between obese and lean children: a cohort st
Lijun Wu, Xiaoyuan Zhao, Yue Shen, Guimin Huang, - Genetics and genomics Research - 12 April 2015
The Sequenom MassARRAY platform (BioMiao Biological Technology, Beijing, China) was used to quantitatively examine the methylation of FAIM2 promoter. The genomic DNA was bisulfite-treated using the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. TA novel SNP in promoter region of RP11-3N2. 1 is associated with reduced risk of colorectal cancer
D Ye, Y Hu, F Jing, Y Li, S Gu, X Jiang, Y Mao - Journal of Human Genetics - 05 October 2017
… salting-out procedure [18]. Genotyping for all SNPs was performed by the MassARRAY molecular weight array analysis system (BioMiao Biological Technology Co., Beijing, China). Statistical analysis. Student's t-test and Pearson …
文章搜索
文章搜索
-
Pharmacogenetics-based warfarin dose prediction algorithm for patients with heart valve replacement i
M.Q. Lin1 , J. Zhang, H.F. Qiu , X.B. Xie - Genetics and Molecular Research - July 28, 2017
Whole blood DNA was extracted using a whole blood genomic DNA rapid extraction kit (centrifugal column), (Beijing BioTeke Corporation, Beijing, China.) A time-of-flight mass spectrometry platform (Sequenom) was used for genotyping (BioMiao Biological Technology (Beijing) Co., Ltd., Beijing, China). -
Toll-like receptor 1 (TLR1) Gene SNP rs5743618 is associated with increased risk for tuberculosis in
Hui Qi,Lin Sun,Xirong,Wu, Yaqiong,Jin,JingXiao,Shengfeng Wang - Tuberculosis - March 2015
… MassArray (Sequenom, USA) was used for genotyping all SNPs [24] and this assay was accomplished by Bio Miao Biological Technology (Beijing). 2.3. Cytokine assays. Whole blood was harvested from children in control group with different genotypes of rs5743618 … -
A 3'UTR Polymorphism of IL-6R Is Associated with Chinese Pediatric Tuberculosis
Chen Shen, Hui Qi, Lin Sun, Jing Xiao, Qing-qin Yin, - BioMed Research International - 19 March 2014
… MassArray (Sequenom, USA) was used for genotyping selected tag-SNPs (Gabriel et al., 2009),and this assay was accomplished by Bio Miao Biological Technology (Beijing, China). The primers were designed using iPLEX GOLD (Sequenom, USA) [17]. 2.4 … -
FGFR2 gene polymorphism rs2981582 is associated with non-functioning pituitary adenomas in Chinese Ha
Bin Zhu1, Juan Wang , Lingling Qin , Lei Wang , Yanfei Zheng - Bioscience Reports - 30 August 2018
Polymerase chain reaction (PCR) primer pairs used to amplify FGFR2 rs2981582 were as follows: ACTGCTGCGGGTTCCTAAAG (forward); CACTCATCGCCACTTAATG (reverse). Genotyping was performed by using time-of-flight mass spectrometry on a MassARRAY iPLEX platform (Sequenom, San Diego, CA, U.S.A.) by Bio Miao Biological Technology (Beijing, China). The average genotype call rate for this SNP was >98%.
Strong association of SLC1A1 and DPF3 gene variants with idiopathic male infertility in Han Chinese
Shu-Yuan Liu, Chang-Jun Zhang, Hai-Ying Peng - Asian J Androl - 2016 May 27.
Genotyping of SNPs was performed using the Sequenom MassARRAY platform (Sequenom iPLEX assay, San Diego, CA, USA; Biomiao Biology Corporation, Beijing, China). PCR and single base extension (SBE) primers were designed using the MassARRAY Designer software, version 3.1 (Sequenom, San Diego, CA, USA).Associations of polymorphisms in circadian genes with abdominal obesity in Chinese adult population
DingYe,ShaofangCai, XiyiJiang,YeDing,KunChen - Obesity Research & Clinical Practice - September 2016
… Genotyping for all SNPs was performed by the MassARRAY molecular weight array analysis system (BioMiao Biological Technology Co., Beijing, China). The call rate and consistency rate for each SNP were >93% and 100%, respectively. Statistical analysis …Influence of lifestyle on the FAIM2 promoter methylation between obese and lean children: a cohort st
Lijun Wu, Xiaoyuan Zhao, Yue Shen, Guimin Huang, - Genetics and genomics Research - 12 April 2015
The Sequenom MassARRAY platform (BioMiao Biological Technology, Beijing, China) was used to quantitatively examine the methylation of FAIM2 promoter. The genomic DNA was bisulfite-treated using the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instructions. TA novel SNP in promoter region of RP11-3N2. 1 is associated with reduced risk of colorectal cancer
D Ye, Y Hu, F Jing, Y Li, S Gu, X Jiang, Y Mao - Journal of Human Genetics - 05 October 2017
… salting-out procedure [18]. Genotyping for all SNPs was performed by the MassARRAY molecular weight array analysis system (BioMiao Biological Technology Co., Beijing, China). Statistical analysis. Student's t-test and Pearson …